EG10910

From BioE80 Boot
Jump to: navigation, search

Author Information

Cody Hankins

Basic Information

  • ID: EG10910
  • Name: rpsK
  • Organism: E. coli
  • UniProt ID: P0A7R9 [1]
  • Description: The gene is is encoded as a part of the alpha operon, and is an essential part of the successful operation of a ribosome. The proteins that this gene proves are among the most highly conserved in all of evolutionary record. Has been predicted to contact the N-terminal domain of IF-3 based on footprint studies; exactly how IF-3 interacts with the 30S subunit is controversial. [2] [3]
  • DNA Length: 399 base pairs
  • DNA sequence: ATGGCAGCAGGAATGAAAGGTAAAAGAAGTAGAAGAAGAAAAGAAAGAAAAAATGTTGAACATGGTTGTGCACATATAAAATCAACTTTCAACAATTCAATAGTTACAATTACTGACAGTGTTGGTAATACTTTATCTTGGGCAAGTGCAGGTGGATTAGGTTTTAGAGGTTCAAGAAAAAGCACACCATTTGCAGCACAAATGGCTGCAGAAACAGCAGCTAAAGCGGCTATGGAACATGGATTAAAAAGCATAGAAGTTTATGTAAAAGGACCGGGCTCAGGAAGAGAAGCTGCTATAAGATCTTTACAAGCAGCAGGTCTAGAAGTTACTTTAATAAAGGATGTAACTCCAATACCACATAATGGTTGTAGACCACCAAAGAGAAGAAGAGTATAG
  • Amino Acid length: 129 amino acids
  • Amino Acid sequence: MAKAPIRARKRVRKQVSDGVAHIHASFNNTIVTITDRQGNALGWATAGGSGFRGSRKSTPFAAQVAAERCADAVKEYGIKNLEVMVKGPGPGRESTIRALNAAGFRITNITDVTPIPHNGCRPPKKRRV

Function and Homologs

  • Functional Category: ribonucleoprotein [4]
  • Product: RS11_ECOLI
  • Module: rRNA binding
  • Closest homologous proteins: The top (max three) homologous proteins to this protein, as identified by BLAST searches.
    • SSU ribosomal protein S11p (S14e) [Escherichia coli ISC11]21984%/1e-73/94%[5]
    • 30S ribosomal protein S11 [Escherichia coli], 262/100%/1e-90/99% [6]
    • SSU ribosomal protein S11p (S14e) [Escherichia coli ISC7]214/81%/7e-72/100% [7]
  • Equivalent E. coli / JCVI functional protein: MMSYN1_0646 [8]

Expression

  • Expression Level: medium
  • Expression Level Hypothesis: Because this gene is essential to all sorts of protein synthesis, it is essential that the cell has a high enough concentration to sustain synthesis. However, too much can lead to a sort of overabundance of materials, which can lead to exponential growth, which is not ideal.
  • Expression Level References and Description: [9] [10]
  • Expression Time: Immediately
  • Expression Level Hypothesis: It is very important that it is expressed right out of the gate, because the cell needs it to build alpha operons, which build ribosomes, so the cell can synthesize the necessary materials. Without alpha operons, there is no way the cell can propagate.
  • Expression Time References and Description: [11] [12]

Gene Context

  • Other Components: RNA Polymerase subunit beta (closely related in operation) [13], EG10238 chao16
  • Possible Dependencies: It is essential for there to be a good amount of amino acids to link, so Histidine biosynthesis is essential EG10903
  • Process: This gene produces the alpha operon, something essential for ribosome synthesis.
    • Inputs: Glucose, AAs, ATP
    • Outputs: RNA polymerase subunit alpha [14]