EG12459

From BioE80 Boot
Jump to: navigation, search

Author Information

Lillian Zhu

Basic Information

  • ID: EG12459
  • Name: alsR/RpiR
  • Organism: E. coli
  • Description: This protein plays a role in regulating transcription, acting as a repressor. In E. coli, this gene in particular regulates expression of genes involved in allose transport and catabolism. It becomes deactivated when bound to allose. Like many proteins in the RpiR transcription regulator family, alsR contains a helix-turn-helix motif. [1] The protein is apparently directly bound to DNA in order to downregulate expression (loose parallels to lac operon). [2]
  • DNA Length: 891 base pairs.
  • DNA sequence:

ATGAGCCAGTCAGAGTTTGATTCAGCGCTTCCGAACGGTATAGGGTTAGCGCCTTACCTGCGAATGAAGCAGGAAGGAATGACAGAAAATGAAAGCCGCATCGTGGAGTGGTTACTCAAACCCGGTAACCTGAGTTGTGCACCCGCAATTAAAGATGTCGCAGAAGCTCTGGCGGTATCTGAAGCGATGATAGTTAAGGTATCAAAGCTGCTGGGGTTTAGCGGCTTTCGTAACTTACGCAGTGCGCTGGAAGATTATTTTTCTCAGTCAGAACAGGTATTGCCTTCCGAGTTGGCTTTTGATGAAGCGCCGCAGGATGTGGTGAATAAGGTATTTAACATCACTTTACGCACCATTATGGAAGGTCAGTCGATCGTCAACGTTGATGAGATCCACCGTGCCGCCCGCTTTTTCTATCAGGCCAGACAGCGGGATTTGTACGGTGCCGGAGGATCAAATGCTATCTGTGCTGATGTACAGCACAAGTTCTTGCGCATTGGCGTACGCTGTCAGGCCTATCCTGATGCTCACATCATGATGATGTCCGCTTCGTTGTTACAGGAAGGAGATGTTGTGCTGGTAGTGACCCATTCCGGGCGAACCAGTGATGTAAAAGCGGCCGTAGAACTGGCAAAAAAGAACGGGGCAAAGATTATTTGTATAACCCATAGCTACCATTCACCGATAGCGAAACTGGCCGATTATATTATTTGCTCACCAGCCCCGGAAACGCCGTTATTAGGTCGTAATGCCTCGGCAAGAATATTACAACTAACTTTGCTGGACGCTTTTTTTGTCTCTGTCGCCCAGCTCAACATTGAACAAGCTAATATTAATATGCAAAAAACCGGCGCAATTGTTGATTTCTTCTCACCAGGCGCGCTGAAATAA

  • Amino Acid length: 296 amino acids.
  • Amino Acid sequence:

MSQSEFDSALPNGIGLAPYLRMKQEGMTENESRIVEWLLKPGNLSCAPAIKDVAEALAVSEAMIVKVSKLLGFSGFRNLRSALEDYFSQSEQVLPSELAFDEAPQDVVNKVFNITLRTIMEGQSIVNVDEIHRAARFFYQARQRDLYGAGGSNAICADVQHKFLRIGVRCQAYPDAHIMMMSASLLQEGDVVLVVTHSGRTSDVKAAVELAKKNGAKIICITHSYHSPIAKLADYIICSPAPETPLLGRNASARILQLTLLDAFFVSVAQLNIEQANINMQKTGAIVDFFSPGALK

Function and Homologs

  • Product: AlsR protein, member of rpiR family
  • Closest homologous proteins: The top (max three) homologous proteins to this protein, as identified by BLAST searches.
    • TH-type transcriptional regulator rpiR [Escherichia sp. 4_1_40B], 612/100%/0.0/100%, [link EIG72795.1]
    • Transcriptional regulator of D-allose utilization, RpiR family [Klebsiella pneumoniae IS22], 612/100%/0.0/99%, CDK79341.1
    • transcriptional regulator [Shigella sp. PAMC 28760], 611/100%/0.0/99%, AMR21503.1

Expression

  • Expression Level: low.
    • Expression Level References and Description: Where did you gather the expression level information from? Provide links where appropriate.
  • Expression Time: At which time should the gene be expressed in the lifecycle of our organism? Specify either [right at beginning; early; late; unknown/impossible to tell].
    • Expression Time References and Description: Where did you gather the expression time information from? Provide links where appropriate.

Gene Context

  • Other Components in the functional module. Provide one other component in the functional module you selected.
  • Possible Dependencies: Other components on which the functional module depends, but that are not part of the module itself. Specify one possible dependency, if applicable.
  • Reactions: What reaction(s) does the functional module catalyze? Specify one reaction the module performs.

Construct

We will handle this - not part of your assignment

  • Synthesis Score: The synthesis score: 1, 2,3
  • Predicted Translation Rate: Prediction of construct translation rate from the RBS calculator
  • Design Notes and Details:
  • GenBank File: A link to the GenBank file. file
  • [1] EcoCyc
  • [2] GO database
  • Retrieved from "http://e80boot.org/index.php?title=EG12459&oldid=8026"