MMSYN1 0126

From BioE80 Boot
Jump to: navigation, search

Author Information

Michael Morrissey: 06024019

Basic Information

  • ID: MMSYN1_0126
  • Name: gluRs
  • Organism: JCVI3.0
  • Description: Catalyzes the attachment of glutamate to tRNA(Glu) in a two-step reaction: glutamate is first activated by ATP to form Glu-AMP and then transferred to the acceptor end of tRNA(Glu). Source: uniprot.org
  • DNA Length: 1449.
  • DNA sequence:

ATGAGCTTCAGATTGCGTTACGCGCCATCTCCTACAGGATTTCTTCATATCGGAAACACTCGGACCGCATTGATGAACTACCTGTTTGCAAAGCACTACAATGGTTCGTTTATTGTGCGCATTGAGGATACGGACCTGACGAGAAATGTCGATGGTGCCATTGAATCTCAATTCGAGAATCTTAACTGGTTAGGCATATTCCCGGATGAGTCAATCTTTAATGTCGGGGACCAGAAATACGGGAAGTATATGCAATCCCAGAAGTTTGACAGATATAAACAGTTGGCGGAACAATTAGTTGACCAAAACAAAGCCTACAGATGTTTCTGTACATCCGAGGAGCTGGAGAAGGACTATGAGGAACAAACCTCTAAGGGTATTATTGCCACGAAGTATTCGCAGAAATGTTTGTTCCTGACCCAAGATCAAATACAAAAAAACCTTGAGAACAAAAAAGAATACTCCATCCGCTTCAAGGTGCCCGAGAACAAGACTTGGACGATCAATGACATAGTAAGAGGCGACGTTAGCTTTGACTCAAAAGACCTGGGAGACTTCGTAATTTTAAAGAGCAATGGGGTAGCCACCTATAATTTTGCCGTGGTTATTGATGACTATGATATGCAGATCACTCACGTATTAAGAGGCGAGGAACACATATCAAACACCCCACGGCAAATGATGATATATGACGCTTTTAATTGGAATTATCCCAAGTTCGGCCACCTGACGCTGATTGTCGATAACACCGGAAAAAAACTGTCCAAGAGATCAGGAAATGCTCTGTTTTTCATAGAGCAATACAAAAAGCAAGGATACCTGAGTCAAGCGATCTTCAACTACATAGCATTGTTGGGATGGAGCCCACCGGGCGAACAGGAAATACTGTCCCAAAACGAACTTATTAAAATCTTTGATGAAAAACGGTTTTCTAAATCCCCGTCTACCTTTGATATGGTTAAAATGAAGTGGATTAACTCTGTGTATATGAAGAAATTAGATGACGACAAGTACCTTGAGTTTGTCAAGTCATTTATTAATACAAATAAGTTTGACATAACGTCAAAAAGCGAGGCCTGGCTTAATCACCTGTTACTGTTGTACAAAAAAGAGCTGGAGTATGCTGAACAAATCAATGATCACCTGGATTTATTTTTTAATAAGAACACTTTGGACAATAACACCATTGACGTGCTGAACAATCTTACCAACTATAAGAACGTCGTTGAGATTTTTAAGAATCAGATCAACGACCTTAAAGACTGGACGATCGAAAACATAAAGCAAATAATAAAAAACACCTCGACGTTGGCGAATGTCAAAGGAAAAGACTTATTCATGCCGATACGCATTTTTGCTACGAAATCCGAGCACGGCCCTAGCCTGGCTGATGTTATATACTTGTTAGGTAAGACAACCGTATTGAATAACATAAATTCGCTGGAGAGA

  • Amino Acid length: 483 amino acids.
  • Amino Acid sequence:

MSFRLRYAPSPTGFLHIGNTRTALMNYLFAKHYNGSFIVRIEDTDLTRNVDGAIESQFENLNWLGIFPDESIFNVGDQKYGKYMQSQKFDRYKQLAEQLVDQNKAYRCFCTSEELEKDYEEQTSKGIIATKYSQKCLFLTQDQIQKNLENKKEYSIRFKVPENKTWTINDIVRGDVSFDSKDLGDFVILKSNGVATYNFAVVIDDYDMQITHVLRGEEHISNTPRQMMIYDAFNWNYPKFGHLTLIVDNTGKKLSKRSGNALFFIEQYKKQGYLSQAIFNYIALLGWSPPGEQEILSQNELIKIFDEKRFSKSPSTFDMVKMKWINSVYMKKLDDDKYLEFVKSFINTNKFDITSKSEAWLNHLLLLYKKELEYAEQINDHLDLFFNKNTLDNNTIDVLNNLTNYKNVVEIFKNQINDLKDWTIENIKQIIKNTSTLANVKGKDLFMPIRIFATKSEHGPSLADVIYLLGKTTVLNNINSLER

Function and Homologs

  • Product: Glutamate--tRNA ligase
  • Closest homologous proteins: The top (max three) homologous proteins to this protein, as identified by BLAST searches.
    • glutamate--tRNA ligase [Mycoplasma leachii], 983/100%/0.0/99%, [1]
    • glutamate--tRNA ligase [Acholeplasma multilocale], 739/99%/0.0/71%, [2]
    • glutamate--tRNA ligase [Mesoplasma chauliocola], 716/98%/0.0/71%, [3]
  • Equivalent E. coli / JCVI functional protein: EG10407.

Expression

  • Expression Level: Low
  • Expression Level Hypothesis: This gene is responsible for binding a specific amino acid to tRNA. Perhaps because this is only one out of 21 total amino acids, the cell only needs it in low levels
  • Expression Level References and Description: Mycoplasma genitalium simulation results provided in assignment specs. [4]
  • Expression Time: right at beginning
  • Expression Time Hypothesis: Because this protein is integral in transcribing future proteins that use the amino acid glutamate, it is essential to have right at the begginning to accommodate any other early proteins that require glutamate.
  • Expression Time References and Description: Expression time was inferred from function found on proto.com part 1.

Gene Context

  • Other Components: This enzyme is its own functional module.
  • Possible Dependencies: tRNA(glu), glutamate, ATP. [5]
  • Process: attaches glutemate to the appropriate tRNA
    • Inputs: ATP, L-glutamate, tRNA(Glu)
    • Outputs: AMP, diphosphate, L-glutamyl-tRNA(Glu)

Construct

We will handle this - not part of your assignment

  • Synthesis Score: The synthesis score: 1, 2,3
  • Predicted Translation Rate: Prediction of construct translation rate from the RBS calculator
  • Design Notes and Details:
  • GenBank File: A link to the GenBank file. file