MMSYN1 0414 Ecoli

From BioE80 Boot
Jump to: navigation, search

Author Information

Lanting Lu

Basic Information

  • ID: EG10835
  • Name: relA
  • Organism: E. coli
  • Description:

RelA is a key enzyme involved in the stringent response of Escherichia coli to amino acid starvation. Stringent response is a stress response of bacteria and plant chloroplasts in reaction to stress conditions such as aminao acid starvation, fatty acid limitation, etc (Haseltine, 1973 PMC 433543). Then, the global regulatory molecules of the stringent response ppGpp and pppGpp are synthesized through a ribosomal mechanism. The global transcriptional regulator (p)ppGpp (guanosine-3'-diphosphate-5'-triphosphate and guanosine-3',5'-bisphosphate, collectively) produced by the relA and spoT genes in Escherichia coli allows bacteria to adapt to different environmental stresses (Bugrysheva, 2005). The amino acid sequence of RelA has been shown to be extensively related to that of SpoT (Metzger, 1989). RelA's catalytic activity is located in the N-terminal portion of the molecule, while the C-terminal portion may have a regulatory function (Gropp, 2001). Mutations located in the synthetase domain of relA results in reduced ppGpp synthesis (Montero, 2014). The synthesis of metabolically stable relA proteins is facilitated by strains with missense mutations, which are point mutations in which a single nucleotide change results in a codon that codes for a different amino acid, in different positions of the N-terminal coding regions of relA. Homologs of RelA and SpoT are members of the RelA/SpoT Homolog (RSH) superfamily. This superfamily has been divided into 30 subgroups comprising long RSHs, small alarmone synthetases (SASs) and small alarmone hydrolases (SAHs) (Atkinson, 2011). RelA is a ribosome-associated (p)ppGpp synthetase that is activated by the binding of uncharged tRNA to its cognate codon on the acceptor site (A site) of a translating ribosome in response to amino acid starvation (Haseltine 1973, Payoe 2011). These conditions allow ppGpp to be synthesized while RNA synthesis is inhibited. In vivo studies allowed models of relA function to be proposed. The model describes RelA hopping between blocked ribosomal complexes during the stringent response, allowing a relatively low concentration of the enzyme to produce sufficient ppGpp (Wendrich, 2002). Recently, in vivo studies shed light on intracellular RelA catalytic cycle using fluorescence imaging. Results show that under nonstarvation conditions, RelA is ribosom-associated, but dissociates for an extended time period after activation to perform its catalytic cycle. Ribosome association was not necessary to trigger each ppGpp biosynthesis cycle. Heat stress caused fast activation of RelA with a rapid return to its inactive state, suggesting an excitable response mechanism for rapid adaptation to environmental changes (English, 2011). Another fluorescent imaging study also showed that ppGpp is synthesized during starvation while RelA is bound to the ribosome (Li, 2016). Apart from its known function, mutant studies have also suggested that RelA may have other as yet undefined roles in ribosome function apart from its (p)ppGpp synthetase activity (Kim, 2009). Several relA mutant alleles were shown to confer temperature-sensitive phenotypes, suggesting that ppGpp may be required for the expression of genes involved in thermotolerance (Yang, 2003).

Sources:

-Haseltine WA, Block R (1973). "Synthesis of guanosine tetra- and pentaphosphate requires the presence of a codon-specific, uncharged transfer ribonucleic acid in the acceptor site of ribosomes." Proc Natl Acad Sci U S A 70(5);1564-8. PMID: 4576025

-Borrelia burgdorferi rel is responsible for generation of guanosine-3'-diphosphate-5'-triphosphate and growth control. Bugrysheva, J.V., Bryksin, A.V., Godfrey, H.P., Cabello, F.C. Infect. Immun. (2005) [Pubmed]

-Metzger S, Sarubbi E, Glaser G, Cashel M (1989). "Protein sequences encoded by the relA and the spoT genes of Escherichia coli are interrelated." J Biol Chem 1989;264(16);9122-5. PMID: 2542299

-Gropp M, Strausz Y, Gross M, Glaser G (2001). "Regulation of Escherichia coli RelA requires oligomerization of the C-terminal domain." J Bacteriol 183(2);570-9. PMID: 11133950

-Montero M, Rahimpour M, Viale AM, Almagro G, Eydallin G, Sevilla A, Canovas M, Bernal C, Lozano AB, Munoz FJ, Baroja-Fernandez E, Bahaji A, Mori H, Codoner FM, Pozueta-Romero J (2014). "Systematic production of inactivating and non-inactivating suppressor mutations at the relA locus that compensate the detrimental effects of complete spot loss and affect glycogen content in Escherichia coli." PLoS One 9(9);e106938. PMID: 25188023

-Atkinson GC, Tenson T, Hauryliuk V (2011). "The RelA/SpoT homolog (RSH) superfamily: distribution and functional evolution of ppGpp synthetases and hydrolases across the tree of life." PLoS One 6(8);e23479. PMID: 21858139

-Haseltine WA, Block R (1973). "Synthesis of guanosine tetra- and pentaphosphate requires the presence of a codon-specific, uncharged transfer ribonucleic acid in the acceptor site of ribosomes." Proc Natl Acad Sci U S A 70(5);1564-8. PMID: 4576025

-Wendrich TM, Blaha G, Wilson DN, Marahiel MA, Nierhaus KH (2002). "Dissection of the mechanism for the stringent factor RelA." Mol Cell 10(4);779-88. PMID: 12419222

-English BP, Hauryliuk V, Sanamrad A, Tankov S, Dekker NH, Elf J (2011). "Single-molecule investigations of the stringent response machinery in living bacterial cells." Proc Natl Acad Sci U S A 108(31);E365-73. PMID: 21730169

-Li W, Bouveret E, Zhang Y, Liu K, Wang JD, Weisshaar JC (2016). "Effects of amino acid starvation on RelA diffusive behavior in live Escherichia coli." Mol Microbiol 99(3);571-85. PMID: 26480956

-Kim09a: Kim HM, Ryou SM, Song WS, Sim SH, Cha CJ, Han SH, Ha NC, Kim JH, Bae J, Cunningham PR, Lee K (2009). "Genetic analysis of the invariant residue G791 in Escherichia coli 16S rRNA implicates RelA in ribosome function." J Bacteriol 191(7);2042-50. PMID: 19168615

-Yang X, Ishiguro EE (2003). "Temperature-sensitive growth and decreased thermotolerance associated with relA mutations in Escherichia coli." J Bacteriol 185(19);5765-71. PMID: 13129947

  • DNA Length: 2235 base pairs.
  • DNA sequence:

ATGGTGGCCGTGCGCTCAGCCCATATTAATAAGGCGGGAGAGTTTGACCCAGAAAAATGGATCGCGAGCCTTGGCATTACCTCTCAAAAATCCTGTGAATGTCTTGCAGAGACCTGGGCGTATTGTCTGCAACAGACTCAAGGACACCCTGATGCCAGTTTACTTCTGTGGCGCGGCGTGGAAATGGTGGAAATCTTAAGTACACTTTCTATGGATATCGATACTCTTCGCGCGGCTTTGTTGTTTCCCTTGGCAGACGCGAACGTAGTCTCAGAAGATGTCTTGCGTGAGTCTGTTGGAAAGAGCGTAGTGAACCTTATCCACGGGGTACGTGATATGGCCGCAATTCGTCAATTGAAAGCCACTCACACCGATTCTGTGTCTTCGGAGCAGGTTGACAACGTCCGCCGCATGTTATTGGCAATGGTGGACGACTTTCGTTGTGTGGTCATCAAGCTGGCGGAACGCATTGCTCACTTACGTGAAGTGAAAGACGCCCCTGAAGACGAACGTGTGCTGGCTGCCAAGGAATGTACGAATATCTATGCACCACTTGCCAACCGTCTTGGTATTGGTCAACTGAAGTGGGAACTTGAAGATTACTGTTTCCGCTATCTTCACCCGACAGAGTACAAACGTATTGCAAAATTATTGCATGAACGTCGTTTAGATCGTGAACATTATATCGAGGAATTTGTCGGGCACCTTCGCGCAGAGATGAAGGCCGAGGGCGTTAAAGCTGAGGTTTACGGCCGTCCAAAGCATATTTATAGTATTTGGCGCAAGATGCAAAAAAAAAATCTTGCGTTCGACGAGCTTTTTGACGTCCGTGCGGTGCGTATTGTCGCTGAACGTTTGCAAGACTGCTACGCAGCTTTAGGGATTGTGCATACACACTACCGTCATTTGCCAGACGAATTCGATGATTACGTTGCCAACCCAAAACCAAATGGGTATCAAAGTATCCATACTGTGGTATTGGGCCCCGGAGGTAAAACGGTGGAGATTCAGATTCGTACGAAGCAAATGCACGAAGATGCAGAGTTAGGAGTTGCCGCACACTGGAAGTACAAAGAGGGGGCAGCAGCGGGAGGAGCGCGTTCGGGGCACGAGGACCGCATCGCTTGGTTACGTAAACTTATTGCTTGGCAGGAAGAGATGGCCGACAGCGGAGAAATGTTGGACGAAGTCCGTTCCCAGGTTTTTGACGACCGCGTCTATGTCTTTACTCCAAAGGGGGACGTCGTAGACCTTCCGGCTGGATCAACGCCCCTGGATTTTGCATATCACATTCATTCCGATGTTGGCCATCGCTGCATCGGAGCTAAAATTGGTGGGCGCATCGTGCCCTTTACTTACCAGTTACAGATGGGGGATCAAATCGAGATTATTACGCAGAAGCAACCTAACCCATCTCGTGATTGGCTTAATCCGAACTTAGGCTATGTTACGACGTCACGTGGGCGTTCGAAAATTCACGCGTGGTTCCGTAAACAAGATCGCGACAAAAATATTTTGGCTGGTCGTCAAATTTTGGACGACGAGTTAGAACACCTTGGGATCTCCCTGAAAGAAGCCGAGAAGCATTTACTGCCCCGCTACAACTTCAATGACGTGGACGAGCTGCTGGCGGCGATCGGAGGGGGTGACATCCGTCTGAACCAAATGGTTAACTTCCTGCAATCGCAGTTTAACAAACCTTCTGCTGAAGAACAGGACGCGGCCGCACTTAAGCAGTTACAACAAAAATCTTACACGCCACAGAACCGCAGCAAGGATAACGGGCGCGTGGTCGTAGAGGGCGTAGGCAATTTAATGCATCATATCGCGCGCTGCTGCCAGCCTATCCCCGGTGACGAAATCGTTGGTTTCATTACTCAGGGACGCGGGATCAGCGTGCATCGCGCAGACTGCGAACAGCTGGCAGAACTGCGTTCTCACGCGCCAGAACGTATCGTAGACGCAGTATGGGGTGAGTCTTATTCTGCTGGGTACTCACTGGTCGTACGTGTGGTTGCGAATGACCGCAGCGGCCTGTTACGCGATATCACCACCATCCTGGCCAATGAGAAAGTTAATGTCCTTGGTGTCGCCAGTCGCAGTGACACGAAACAACAGTTGGCGACAATTGACATGACGATTGAGATTTACAATTTGCAAGTGCTTGGGCGCGTTCTTGGAAAATTGAATCAAGTCCCAGACGTAATTGACGCTCGCCGTCTGCACGGATCATAA

  • Amino Acid length: 744 amino acids.
  • Amino Acid sequence:

MVAVRSAHIN KAGEFDPEKW IASLGITSQK SCECLAETWA YCLQQTQGHPDASLLLWRGV EMVEILSTLS MDIDTLRAAL LFPLADANVV SEDVLRESVGKSVVNLIHGV RDMAAIRQLK ATHTDSVSSE QVDNVRRMLL AMVDDFRCVVIKLAERIAHL REVKDAPEDE RVLAAKECTN IYAPLANRLG IGQLKWELEDYCFRYLHPTE YKRIAKLLHE RRLDREHYIE EFVGHLRAEM KAEGVKAEVYGRPKHIYSIW RKMQKKNLAF DELFDVRAVR IVAERLQDCY AALGIVHTHYRHLPDEFDDY VANPKPNGYQ SIHTVVLGPG GKTVEIQIRT KQMHEDAELGVAAHWKYKEG AAAGGARSGH EDRIAWLRKL IAWQEEMADS GEMLDEVRSQVFDDRVYVFT PKGDVVDLPA GSTPLDFAYH IHSDVGHRCI GAKIGGRIVPFTYQLQMGDQ IEIITQKQPN PSRDWLNPNL GYVTTSRGRS KIHAWFRKQDRDKNILAGRQ ILDDELEHLG ISLKEAEKHL LPRYNFNDVD ELLAAIGGGDIRLNQMVNFL QSQFNKPSAE EQDAAALKQL QQKSYTPQNR SKDNGRVVVEGVGNLMHHIA RCCQPIPGDE IVGFITQGRG ISVHRADCEQ LAELRSHAPERIVDAVWGES YSAGYSLVVR VVANDRSGLL RDITTILANE KVNVLGVASRSDTKQQLATI DMTIEIYNLQ VLGRVLGKLN QVPDVIDARR LHGS

Function and Homologs

  • Product: GTP pyrophosphokinase
  • Module: Kinase
  • Closest homologous proteins: The top (max three) homologous proteins to this protein, as identified by BLAST searches.
    • Name:TRAM and TGS and ACT 4 and tRNA U5-meth tr and HD 4 and RelA SpoT domain containing protein [Trichuris trichiura], Max score: 1544, Query Cover: 100%, E-Value: 0.0, Identity: 100%, [CDW60211.1]
    • Name: MULTISPECIES: GTP pyrophosphokinase [Proteobacteria], Max score: 1539, Query Cover: 100%, E-Value: 0.0 Identity: 100%, [WP_000226815.1]
    • Name:GTP pyrophosphokinase [Shigella dysenteriae], Max score: 1538, Query Cover: 100%, E-Value: 0.0, Identity: 99%, [WP_024250278.1]

Expression

  • Expression Level: medium
    • Expression Level References and Description: The expression level (medium) was determined through looking at the Ecoli Proteomic Expression Data. Because relA is involved in the stringent reponse in bacteria, it should be expressed to a medium level so that there will be enough of a response to preserve amino acids but not too much because it need only be activated in stress conditions for Ecoli.
  • Expression Time: early
    • Expression Time References and Description: relA should be expressed early on because it is involed in the ppGpp biosynthesis pathway, which allows for stringent response in bacteria. This response causes the inhibition of RNA synthesis when there is a shortage of amino acids, thus decreasing translation and conserving amino acids. This stringent reponse pathway should be activated early so that if cells encounter stress conditions such as amino acid starvation, heat shock, fatty acid limitation and so on.

Sources: http://www.sciencedirect.com/science/article/pii/S136952740800009X?via%3Dihub https://en.wikipedia.org/wiki/Stringent_response#cite_note-Haseltine1973-1

Gene Context

  • Other Components in the functional module: spoT; EG10966
  • Possible Dependencies: guanine nucleotide-binding proteins that hydrolyze guanosine triphosphate (GTP) to guanosine diphosphate (GDP)
  • Process: ppGpp biosynthesis
    • Inputs: ATP, GDP
    • Outputs: AMP, ppGpp

Source: https://ecocyc.org/gene?orgid=ECOLI&id=EG10835

Construct

  • Synthesis Score: The synthesis score of your construct: 1, 2,3
  • Predicted Translation Rate: Prediction of construct translation rate from the RBS calculator
  • Design Notes and Details: For example, had to use a rare codon to fix folding energy;
  • GenBank File: A link to the GenBank file. file