MMSYN1 0620

From BioE80 Boot
Jump to: navigation, search

Author Information

Sabar Dasgupta

Basic Information

  • ID: MMSYN1_0620
  • Name: fur
  • Organism: JCVI-Syn3.0
  • Description: The fur gene expresses the ferric uptake regulator protein (Fur) and is the "founding member" of a family of proteins that regulate uptake and homeostasis of various metal ions. The Fur protein regulates the concentration of iron—an essential function. According to Uniprot, this protein regulates iron levels by sequence-specific DNA binding, meaning that the Fur protein selectively binds to DNA and prevents transcription of genes that cause iron uptake. However, when iron concentrations are low, the Fur protein undergoes a conformational change and can no longer bind to DNA to prevent transcription (Wikipedia).
  • DNA Length: 465 base pairs.
  • DNA sequence:

ATGATTCATCTGTCTAAAACTCAACAAACAAAGTACAAGCAAATTGTTGAGAAATTGAAGCTGAAGAAGATCCGCTTGACAGACATCCGTTCAATCGTTATTAAGATGCTTATTGTTTCTGACCACCTGACAATTCAACAGATCATTAATAATTTAGAATCAGAGATTAACAACATCAACGTCATGTCCGTGTACAATACGATTGATCTGTTGTTGAAAGAGCATATCGTTTTCGCTAATACCTTCAACGGCAAAGACATTTCCTACGAAATCGCAGCCGATAAATCTGTCCATTTAAAATGCGATGACTGCCTGAAAGTTATTCATCTGGACGATAAATCCATCGAGAATTACCATTTCTTAGAATTGCTTGATCTTTGCGAGAAGAATGGCATTAAGTTGAGTCACTTTAAGATCGAGGGTCATGGATACTGCTTGGAGTGTTCAAGTAAGGAGAATAAGTAA

  • Amino Acid length: 154 amino acids.
  • Amino Acid sequence:

MIHLSKTQQTKYKQIVEKLKLKKIRLTDIRSIVIKMLIVSDHLTIQQIINNLESEINNINVMSVYNTIDLLLKEHIVFANTFNGKDISYEIAADKSVHLKCDDCLKVIHLDDKSIENYHFLELLDLCEKNGIKLSHFKIEGHGYCLECSSKENK

Function and Homologs

  • Product: Ferric uptake regulator
  • Closest homologous proteins: The top (max three) homologous proteins to this protein, as identified by BLAST searches.
    • ferric uptake regulator family protein [Mycoplasma feriruminatoris], 286/98%/1e-97/94%, WP_008364161.1
    • Fur family transcriptional regulator [Mycoplasma capricolum], 271/98%/1e-91/90%, WP_011387508.1
    • Fur family transcriptional regulator [Mycoplasma leachii], 269,98%,9e-91,89%, WP_013447933.1
  • Equivalent E. coli functional protein: EG10359

Expression

  • Expression Level: low
  • Expression Level Hypothesis: Regulation of iron levels may not require a huge number of proteins if iron uptake is not being inhibited. In an environment with a very small amount of iron, the expression level of this gene would likely be higher.
  • Expression Level References and Description: 3 proteins per cell in M. genitalium model data.
  • Expression Time: At which time should the gene be expressed in the lifecycle of our organism? Early
  • Expression Level Hypothesis: If this gene is not expressed relatively early, then iron levels will not be able to be regulated effectively.
  • Expression Time References and Description: Uniprot. According to WikiGenes, the protein expressed by this gene is versatile and plays a role in homeostasis beyond just iron regulation.

Gene Context

  • Other Components: There are other components to this family (Manganese uptake regulator (Mur), Nickel uptake regulator (Nur), peroxide regulator (PerR), and Zinc uptake regulator (Zur)) in other species, but none of these genes were found in the JCVI databases.
  • Possible Dependencies: The presence (or lack) Fe2+ is a main dependency of this gene, but this gene actually regulates itself, so there aren't other genes working directly to regulate iron in the same way. You could count the DNA itself as a trivial dependency.
  • Process: Fur-Fe2+ DNA-binding transcriptional dual regulation
    • Inputs: Fur, Fe2+
    • Outputs: Fur-Fe2+ (compound binds to DNA to prevent transcription)